How to use commands to sort the series in fasta format by length

Source: Internet
Author: User
How to use commands to sort the series in the fasta format by length-Linux general technology-Linux technology and application information. The following is a detailed description. Who knows how to use commands to sort the text content in fasta format by the length of each sequence, in the following format,
> Werse
ACGTGCTACGTAGCTACGTAGTACTAGCTAGCT
> Fdsfkj
ACGBNDJKAHDAHDCJBJCHJSHC
> Swde
SDASIDJIASHCNDCHSDUHCUHDCUDNSUCVBDSUHVUD
.......
Which of the following statements can help you sort by the length of each sequence? Thank you !!!

Contact Us

The content source of this page is from Internet, which doesn't represent Alibaba Cloud's opinion; products and services mentioned on that page don't have any relationship with Alibaba Cloud. If the content of the page makes you feel confusing, please write us an email, we will handle the problem within 5 days after receiving your email.

If you find any instances of plagiarism from the community, please send an email to: info-contact@alibabacloud.com and provide relevant evidence. A staff member will contact you within 5 working days.

A Free Trial That Lets You Build Big!

Start building with 50+ products and up to 12 months usage for Elastic Compute Service

  • Sales Support

    1 on 1 presale consultation

  • After-Sales Support

    24/7 Technical Support 6 Free Tickets per Quarter Faster Response

  • Alibaba Cloud offers highly flexible support services tailored to meet your exact needs.