[Leetcode] Repeated DNA sequences

Source: Internet
Author: User

All DNA are composed of a series of nucleotides abbreviated as a, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it's sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "aaaaacccccaaaaaccccccaaaaagggttt", return:["AAAAACCCCC", "CCCCCAAAAA"].

Using the map Word super memory, instead of Bitsmap, because only 4 letters, so as long as two bits can be used as a letter encoding, 10 letters is 20 bits, so create an array of 2^20 size can solve the problem.

1 classSolution {2  Public:3     intGetval (Charch) {4         if(ch = ='A')return 0;5         if(ch = ='C')return 1;6         if(ch = ='G')return 2;7         if(ch = ='T')return 3;8     }9     Tenvector<string> findrepeateddnasequences (strings) { One         Set<string>St; Avector<string>Res; -         stringstr; -         if(S.length () <Ten|| s = ="")returnRes; the         intmp[1024x768*1024x768] = {0}; -Unsignedintval =0; -          for(inti =0; I <9; ++i) { -Val <<=2; +Val |=getval (S[i]); -         } +          for(inti =9; I < s.length (); ++i) { AVal <<= -; atVal >>= A; -Val |=getval (S[i]); -++Mp[val]; -             if(Mp[val] >1) { -str = S.SUBSTR (i-9,Ten); - St.insert (str); in             } -         } to          for(Set<string>::iterator i = St.begin (); I! = St.end (); ++i) { +Res.push_back (*i); -         } the         returnRes; *     } $};

[Leetcode] repeated DNA sequences

Contact Us

The content source of this page is from Internet, which doesn't represent Alibaba Cloud's opinion; products and services mentioned on that page don't have any relationship with Alibaba Cloud. If the content of the page makes you feel confusing, please write us an email, we will handle the problem within 5 days after receiving your email.

If you find any instances of plagiarism from the community, please send an email to: info-contact@alibabacloud.com and provide relevant evidence. A staff member will contact you within 5 working days.

A Free Trial That Lets You Build Big!

Start building with 50+ products and up to 12 months usage for Elastic Compute Service

  • Sales Support

    1 on 1 presale consultation

  • After-Sales Support

    24/7 Technical Support 6 Free Tickets per Quarter Faster Response

  • Alibaba Cloud offers highly flexible support services tailored to meet your exact needs.