[Leetcode] Repeated DNA sequences

All DNA are composed of a series of nucleotides abbreviated as a, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it's sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "aaaaacccccaaaaaccccccaaaaagggttt", return:["AAAAACCCCC", "CCCCCAAAAA"].

Using the map Word super memory, instead of Bitsmap, because only 4 letters, so as long as two bits can be used as a letter encoding, 10 letters is 20 bits, so create an array of 2^20 size can solve the problem.

1 classSolution {2  Public:3     intGetval (Charch) {4         if(ch = ='A')return 0;5         if(ch = ='C')return 1;6         if(ch = ='G')return 2;7         if(ch = ='T')return 3;8     }9     Tenvector<string> findrepeateddnasequences (strings) { One         Set<string>St; Avector<string>Res; -         stringstr; -         if(S.length () <Ten|| s = ="")returnRes; the         intmp[1024x768*1024x768] = {0}; -Unsignedintval =0; -          for(inti =0; I <9; ++i) { -Val <<=2; +Val |=getval (S[i]); -         } +          for(inti =9; I < s.length (); ++i) { AVal <<= -; atVal >>= A; -Val |=getval (S[i]); -++Mp[val]; -             if(Mp[val] >1) { -str = S.SUBSTR (i-9,Ten); - St.insert (str); in             } -         } to          for(Set<string>::iterator i = St.begin (); I! = St.end (); ++i) { +Res.push_back (*i); -         } the         returnRes; *     } $};

[Leetcode] repeated DNA sequences