LeetCode-Repeated DNA Sequences

LeetCode-Repeated DNA Sequences

 

All DNA is composed of a series of nucleus otides abbreviated as A, C, G, and T, for example: ACGAATTCCG. when studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT,Return:[AAAAACCCCC, CCCCCAAAAA].

Solution Report: Convert standard characters to binary hash tables. If you store data directly using string, the memory times out.

Use (s [I]-'A' + 1) % 5) to convert A, C, G, T to 1, 3, 2, 0; t = (t <2) & 0 xfffff) | (s [I]-'A' + 1) % 5); for 20-bit storage.

 

class Solution {public:    vector
 
   findRepeatedDnaSequences(string s) {        vector
  
    result;        unordered_map
   
     str;        unordered_map
    
     ::iterator it;        int t;        for (int i = 0; i < s.size() ;i++) {            t = ( (t<<2) & 0xfffff) | ( ( s[i] - 'A' + 1 ) % 5 );            if (i < 9)  continue;            it = str.find(t);            if (it == str.end())                str[t] = 1;            else {                if (str[t] == 1) {                    str[t] = 2;                    result.push_back(s.substr(i-9,10));                }            }        }        return result;    }};