Poj1699:best Sequence (DP)

Description

The Twenty-first century is a biology-technology developing century. One of the most attractive and challenging tasks are on the gene project, especially in the gene sorting program. Recently we know a gene is made of DNA. The nucleotide bases from which DNA was built is A (adenine), C (cytosine), G (guanine), and T (thymine). Given several segments of a gene, you is asked to make a shortest sequence from them. The sequence should use all the segments, and you cannot flip any of the segments.

For example, given ' tcgg ', ' gcag ', ' CCGC ', ' gatc ' and ' ATCG ', you can slide the segments in the following and get a SE Quence of length 11. It is the shortest sequence (and may be isn't the only one).

Input

The first line was an integer t (1 <= t <=), which shows the number of the cases. Then T test cases follow. The first line of every test case contains an integer n (1 <= n <=), which represents the number of segments. The following n lines express n segments, respectively. Assuming the length of any segment is between 1 and 20.

Output

For each test case, print a line containing the length of the shortest sequence that can is made from these segments.

Sample Input

15TCGGGCAGCCGCGATCATCG

Sample Output

11

Source

POJ monthly--2004.07.18

And HDU1560 is the same problem, the problem I wrote with ida*, if the code is directly submitted to the TLE, then it can only be done in a different way, we can use DP to optimize, DP[I][J], the record I string and the J string merge, remove the coincident part, I still how many, So when we search, we just need to enumerate the combinations of DP arrays.

#include <iostream> #include <stdio.h> #include <string.h> #include <stack> #include <queue > #include <map> #include <set> #include <vector> #include <math.h> #include <algorithm >using namespace std, #define LS 2*i#define rs 2*i+1#define up (i,x,y) for (i=x;i<=y;i++) #define DOWN (i,x,y) for (i=x; i>=y;i--) #define MEM (a,x) memset (A,x,sizeof (a)) #define W (a) while (a) #define LL long longconst double pi = acos (-1.0); # Define Len 100005#define mod 19999997const int INF = 0x3f3f3f3f;char Str[15][25];int t,n,dp[15][15],len[15],vis[15];int C    Al (int x,int y) {int i,j,sum,flag;        Up (i,0,len[x]-1) {int ly = 0;        sum = 0;        Flag = 0;                Up (j,i,len[x]-1) {if (str[x][j]!=str[y][ly]) {flag = 1;            Break            } ly++;        sum++;    } if (!flag) return len[x]-sum; } return len[x];} int dfs (int now,int step) {int ans =Inf,i;    if (step = = N) return Len[now];            Up (i,0,n-1) {if (!vis[i]) {vis[i] = 1;            int tmp = Dp[now][i];            Tmp+=dfs (i,step+1);            Vis[i] = 0;        ans = min (ans,tmp); }} return ans;    int main () {int i,j;    scanf ("%d", &t);        W (t--) {mem (dp,0);        scanf ("%d", &n);            Up (i,0,n-1) {scanf ("%s", Str[i]);        Len[i] = strlen (Str[i]);                } up (i,0,n-1) {up (j,0,n-1) {if (i==j) continue;            DP[I][J] = cal (I,J);        }} mem (vis,0);        int ans = INF;            Up (i,0,n-1) {vis[i] = 1;            ans = min (Ans,dfs (i,1));        Vis[i] = 0;    } printf ("%d\n", ans); } return 0;}

Poj1699:best Sequence (DP)