Perl Practice--fasta Format File sequence GC content calculation &perl Array ordering How to get subscript or key

First, about the procedure:

Fun: Calculates the percent of content in G and C in each sequence in the Fasta file, the output maximum and its ID

Input:fasta Format Files

>seq1
CGCCGAGCGCTTGACCTCCAGCAAGACGCCGTCTGGCACATGCAACGAGCTGTAGCAGAC
>seq2
ATGCCTAGAACGTTCGAGACTTCTCGGGTGCGGTAGAATTAGCCATTCGACCGACTTCCA
GCATCTGCGAGCCGCCTGTTGATTGCATCCGCCGGGGACGCAACAAGGCAAGGCCCTAAC

OUTPUT: The highest level of sequence ID and its content (this is the result above)

seq163.333333%

Second, the concept of programming and code

When it is a comment line (...). ), get the sequence ID, and skip the secondary loop, and when you read a non-commented line that is a sequence row, record the "content of G and C" and "total content of the sequence" in this line, which can be implemented using the Perl context. (But here are some doubts-when the 14 line @num replaced $num will appear calculation error, know friends welcome message)

1 use strict;
  2 my% GC_content; # id => GC_content
  3 my% sequences; # id => sequence
  4 my ($ id, $ sum); # id, number of characters in each sequence
  5 my @num; # intermediate variable, used to store the content of a character in a single line
  6 while (my $ seq = <>) {
  7 chomp ($ seq);
  8 if ($ seq = ~ m / ^> (. *) /) {
  9 $ id = $ 1;
10 next;
11}
12 @num = ($ seq = ~ m / (G | C) / g);
13 $ GC_content {$ id} + = @num;
14 @num = ($ seq = ~ m /(.)/ g);
15 $ sequences {$ id} + = @num;
16}
17
18 foreach (keys (% GC_content)) {
19 $ GC_content {$ _} / = $ sequences {$ _};
20}
21 my @sort = sort ($ GC_content {$ b} <=> $ GC_content {$ a}} keys (% GC_content);
22 printf ("% s \ n% .6f% \ n", $ sort [0], $ GC_content {$ sort [0]} * 100); 

Third, skills

The magic of Perl, the magical sort!!

How to sort an array (or hash) to get the subscript:

 
# Number sort:
my @arr = qw (2 3 41 2 34);
my @ result1 = sort ($ a <=> $ b} @arr;
# Get the subscript:
my @ result2 = sort {$ arr [$ a] <=> $ arr [$ b]} 0 .. $ # arr;
# Get the key:
my% hash = (
     one => 1,
     two => 5,
     tree => 9
);
my @ result3 = sort ($ hash {$ a} <=> $ hash {$ b}} keys (% hash);
print "Number sorting: @ result1 \ nGet subscript: @ result2 \ nGet key: @ result3 \ n";  

Perl Practice--fasta Format File sequence GC content calculation &perl Array ordering How to get subscript or key