Python implements DNA sequence string conversion, complementary chain, reverse chain, reverse complementary chain

Source: Internet
Author: User

In bioinformatics analysis, a series of operations are often performed on DNA sequences, including sub-sequence interception, complementary sequence acquisition, reverse sequence acquisition, and reverse complementary sequence acquisition. In the Python language, you can write the following functions to accomplish these simple functions.

Sub-sequence interception

Using the string slicing feature in Python for sequence interception can be done, for example:

>>> seq="atgatatagtatatatgcaagagg">>> subseq = seq[1:6]> >> subseq"tgata"

Note that the slice operation is "0-base", and the package left does not wrap to the right.

Complementary sequence Acquisition

A more common practice is to define a base substitution dictionary, as follows:

defcomplement (s): Basecomplemt= {         "A":"T",          "T":"A",          "G":"C",          "C": G",          "a":"T",          "T":"a",          "g":"C",          "C":"g",} letters=list (s) Letters= [Basecomplement[base] forBaseinchLetters]return "'. Join (Letters)

The Translate method used with the python3 string

def complement (seq):     return seq.translate (Str.maketrans ('acgtacgtrymkrymkvbhdvbhd ') TGCATGCAYRKMYRKMBVDHBVDH'))

or Python2 Maketrans method in a string package

 from Import Maketrans def complement (seq):     return seq.translate (Maketrans ('acgtacgtrymkrymkvbhdvbhd ') TGCATGCAYRKMYRKMBVDHBVDH'))

Reverse Complementary sequence acquisition
def Revcomp (seq):      return complement (seq) [::-1]
Resources

DNA reverse complementary sequence acquisition

Python implements DNA sequence string conversion, complementary chain, reverse chain, reverse complementary chain

Contact Us

The content source of this page is from Internet, which doesn't represent Alibaba Cloud's opinion; products and services mentioned on that page don't have any relationship with Alibaba Cloud. If the content of the page makes you feel confusing, please write us an email, we will handle the problem within 5 days after receiving your email.

If you find any instances of plagiarism from the community, please send an email to: info-contact@alibabacloud.com and provide relevant evidence. A staff member will contact you within 5 working days.

A Free Trial That Lets You Build Big!

Start building with 50+ products and up to 12 months usage for Elastic Compute Service

  • Sales Support

    1 on 1 presale consultation

  • After-Sales Support

    24/7 Technical Support 6 Free Tickets per Quarter Faster Response

  • Alibaba Cloud offers highly flexible support services tailored to meet your exact needs.