Python implements DNA sequence string conversion, complementary chain, reverse chain, reverse complementary chain

In bioinformatics analysis, a series of operations are often performed on DNA sequences, including sub-sequence interception, complementary sequence acquisition, reverse sequence acquisition, and reverse complementary sequence acquisition. In the Python language, you can write the following functions to accomplish these simple functions.

Sub-sequence interception

Using the string slicing feature in Python for sequence interception can be done, for example:

>>> seq="atgatatagtatatatgcaagagg">>> subseq = seq[1:6]> >> subseq"tgata"

Note that the slice operation is "0-base", and the package left does not wrap to the right.

Complementary sequence Acquisition

A more common practice is to define a base substitution dictionary, as follows:

defcomplement (s): Basecomplemt= {         "A":"T",          "T":"A",          "G":"C",          "C": G",          "a":"T",          "T":"a",          "g":"C",          "C":"g",} letters=list (s) Letters= [Basecomplement[base] forBaseinchLetters]return "'. Join (Letters)

The Translate method used with the python3 string

def complement (seq):     return seq.translate (Str.maketrans ('acgtacgtrymkrymkvbhdvbhd ') TGCATGCAYRKMYRKMBVDHBVDH'))

or Python2 Maketrans method in a string package

 from Import Maketrans def complement (seq):     return seq.translate (Maketrans ('acgtacgtrymkrymkvbhdvbhd ') TGCATGCAYRKMYRKMBVDHBVDH'))

Reverse Complementary sequence acquisition

def Revcomp (seq):      return complement (seq) [::-1]

Resources

DNA reverse complementary sequence acquisition

Python implements DNA sequence string conversion, complementary chain, reverse chain, reverse complementary chain