DNA sorting
Time Limit: 2000/1000 MS (Java/others) memory limit: 65536/32768 K (Java/Others)
Total submission (s): 1924 accepted submission (s): 949
Problem descriptionone measure of ''unsortedness ''in a sequence is the number of pairs of entries that are out of order with respect to each other. for instance, in the letter sequence '''daabec'', this measure is 5, since D is greater than four letters to its right and E is greater than one letter to its right. this measure is called the number of inversions in the sequence. the sequence '''aacedgg ''' has only one inversion (E and D) -- It is nearly sorted -- while the sequence ''zwqm ''has 6 inversions (it is as unsorted as can be -- exactly the reverse of sorted ).
You are responsible for cataloguing a sequence of DNA strings (sequences containing only the four letters A, C, G, and T ). however, you want to catalog them, not in alphabetical order, but rather in order of ''sortedness '', from ''most sorted'' to ''least sorted ''. all the strings are of the same length.
This problem contains multiple test cases!
The first line of a multiple input is an integer N, then a blank line followed by N input blocks. each input block is in the format indicated in the Problem description. there is a blank line between input blocks.
The output format consists of N output blocks. There is a blank line between output blocks.
Inputthe first line contains two integers: a positive integer N (0 <n <= 50) giving the length of the strings; and a positive integer m (1 <m <= 100) giving the number of strings. these are followed by M lines, each containing a string of length N.
Outputoutput the list of input strings, arranged from ''most sorted'' to ''ast sorted ''. if two or more strings are equally sorted, list them in the same order they are in the input file.
Sample input1 10 6 aacatgaaggttttggccaa tttggccaaa gatcagatttcccgggggga atcgatgcat
Sample outputcccggggggaaacatgaagg gatcagatttatcgatgcat ttttttggccaatttggccaaa
#include <iostream>#include <string>#include <algorithm>using namespace std;struct DNA{ string s; int d;};int cmp(DNA a,DNA b){ if(a.d!=b.d)return a.d<b.d; else return 0;}int main(){ int t; int n,m; DNA dna[80]; cin>>t; while(t--) { cin>>n>>m; int i,j; for(i = 0; i < m; ++i){ cin>>dna[i].s; dna[i].d = 0; for(j = 1; j < n; ++j) { for(int k = 0; k < j ;++k) { if(dna[i].s[j] < dna[i].s[k]) dna[i].d++; } } } sort(dna,dna+m,cmp); for(i = 0; i < m; ++i) cout<<dna[i].s<<endl; } return 0;}
View code
# Include <iostream>
# Include <string>
# Include <algorithm>
Using namespace STD;
Struct DNA
{
String S;
Int D;
};
Int CMP (dna a, dna B ){
If (A. D! = B. d) return a. d <B. D;
Else return 0;
}
Int main (){
Int T;
Int n, m;
DNA [80];
Cin> T;
While (t --)
{
Cin> N> m;
Int I, J;
For (I = 0; I <m; ++ I ){
Cin> DNA [I]. S;
DNA [I]. D = 0;
For (j = 1; j <n; ++ J)
{
For (int K = 0; k <j; ++ K)
{
If (DNA [I]. s [J] <DNA [I]. s [k])
DNA [I]. d ++;
}
}
}
Sort (DNA, DNA + M, CMP );
For (I = 0; I <m; ++ I)
Cout <DNA [I]. S <Endl;
}
Return 0;
}